Multiplex 1: K13 and mdr1 (86, 184)

Primers

The first round for multiplex 1 was modified from (Narh et al. 2020) and amplifies two regions of pfk13 and pfmdr1 fragment 1 (mdr1-1; codons 86, 184). Inner primers for each simplex reaction were used from (Narh et al. 2020).

Table 2. Details about primers used in multiplex 1 of the ALARMcoding PCR genotyping protocol
Primer Chromosome Sequence (5' to 3') Reference Nucleotide positiona
Kelch protein (pfk13: PF3D7_1343700)
K13-out-F 13 AGTGGAAGACATCATGTAACCAG 1 1725857-1725835
K13-out-R 13 AATTGCCATCTTTTATTAAATGGTTGA 1 1725013-1725039
K13-in-F1 13 AGCCTTGTTGAAAGAAGCAGA 1 1725720-1725700
K13-in-R1 13 TGATCATATGCTTCTACATTCGGT 1 1725319-1725342
K13-in-F2 13 GGGGGATATGATGGCTCTTCT 1 1725368-1725348
K13-in-R2 13 TCAACGGAATCTAATATGTTATGTTCA 1 1725046-1725072
Multidrug resistance gene 1 (pfmdr1: Pf3D7_0523000)
mdr1-out-F1 5 ACCGTTTAAATGTTTACCTGCACA 1 958021-958044
mdr1-out-R1 5 GCCTCTTCTATAATGGACATGGT 1 958599-958577
mdr1-in-F1 5 GTGCTGTATTATCAGGAGGAACA 1 958077-958099
mdr1-in-R1 5 GCAAGTAATACATAAAGTCAAACGTGC 1 958489-958463
Note: Blank references denote that the primer was created by this author. Manuscript in preparation.
1 Narh et al., 2020 2 Nag et al., 2017
a Nucleotide position relative ot the 3D7 v3 reference genome

PCR Instructions

Round 1.

The first round PCR was carried out in a total Volume of 25 μL with 1 x buffer, 500 μM dNTPs mix (Promega), 5 mM MgCl2, 200 nM of each primer (forward (F) and reverse (R)), 1.3 units of GoTaq Flexi Polymerase (Promega) and 3 μL of genomic DNA.

Reagent Final Concentration Volume x1 (μL) Volume x8 (μL)
Water 8.49 67.92
5X Buffer 1x 5.00 40.00
MgCl2 (25mM) 5 mM 5.00 40.00
dNTP 0.5 μM 1.25 10.00
K13-out-F 0.2 μM 0.50 4.00
K13-out-R 0.2 μM 0.50 4.00
mdr1-1-out-F 0.2 μM 0.50 4.00
mdr1-1-out-R 0.2 μM 0.50 4.00
G2 Flexi Taq (5U/μL) 1.3 U/μL 0.26 2.08

Cycling conditions:

  • 95°C/2 min
  • 40 cycles of:
    • 95°C/20 sec,
    • 58°C/2 min,
    • 72/2 min;
  • 72°C/10 min
  • Resting at 4°C.

Round 2.

The pfk13 fragment 1 (K13-1) simplex PCR was in a total Volume of 25 μL with 1x Buffer, 500 μM dNTPs mix, 1.5 mM MgCl2, 300 nM of each primer (F/R), 1 unit of GoTaq Flexi Polymerase and 2 μL of PCR product from the first round.

Reagent Final Concentration Volume x1 (μL) Volume x8 (μL)
Water 13.05 104.4
5X Buffer 1x 5.00 40.0
MgCl2 (25mM) 2 mM 2.00 16.0
dNTP 0.5 μM 1.25 10.0
K13-1-in-F 0.3 μM 0.75 6.0
K13-1-in-R 0.3 μM 0.75 6.0
G2 Flexi Taq (5U/μL) 1 U/μL 0.20 1.6

The pfk13 fragment 2 (K13-2) simplex PCR °Ccurred with the same concentrations except that only 200 nM per primer (F/R was used).

Reagent Final Concentration Volume x1 (μL) Volume x8 (μL)
Water 13.55 108.4
5X Buffer 1x 5.00 40.0
MgCl2 (25mM) 2 mM 2.00 16.0
dNTP 0.5 μM 1.25 10.0
K13-2-in-F 0.2 μM 0.50 4.0
K13-2-in-R 0.2 μM 0.50 4.0
G2 Flexi Taq (5U/μL) 1 U/μL 0.20 1.6

The simplex reaction for pfmdr1 fragment 1 (mdr1-1) had total Volume of 25 μL with 1x Buffer, 500 μM dNTPs mix, 1.5 mM MgCl2, 200 nM of each primer (F/R), 1.3 units of GoTaq Flexi Polymerase and 2 μL of PCR product from the first round.

Reagent Final Concentration Volume x1 (μL) Volume x8 (μL)
Water 13.99 111.92
5X Buffer 1x 5.00 40.00
MgCl2 (25mM) 1.5 mM 2.00 16.00
dNTP 0.5 μM 1.25 10.00
mdr1-1-in-F 0.2 μM 0.50 4.00
mdr1-1-in-R 0.2 μM 0.50 4.00
G2 Flexi Taq (5U/μL) 1.3 U/μL 0.26 2.08

Cycling conditions for each simplex reaction:

  • 95°C/2 min
  • 40 cycles of:
    • 95°C/20 sec
    • 58°C/2 min
    • 72/2 min;
  • 72°C/10 min
  • Resting at 4°C.

Final Sequences

Table 3. Details about sequences genotyped in the multiplex 1 of the ALARMcoding protocol
Marker Length PCR_Round Codons
Kelch protein (pfk13: PF3D7_1343700)
K13 Round 1 Product 845 1
K13-1 412 2 426-560
K13-2 333 2 542-651
Multidrug resistance gene 1 (pfmdr1: Pf3D7_0523000)
mdr1-1 Round 1 Product 579 1
mdr1-1 423 2 86, 184
Back to top

References

Narh, Charles A, Anita Ghansah, Michael F Duffy, Shazia Ruybal‐Pesántez, Christiana O Onwona, Abraham R Oduro, Kwadwo Ansah Koram, Karen P Day, and Kathryn E Tiedje. 2020. “Evolution of antimalarial drug resistance markers in the reservoir of Plasmodium falciparum infections in the Upper East Region of Ghana.” The Journal of Infectious Diseases. https://doi.org/10.1093/infdis/jiaa286 PMID - 32459360.