| Primer | Chromosome | Sequence (5' to 3') | Reference | Nucleotide positiona |
|---|---|---|---|---|
| Multidrug resistance gene 1 (pfmdr1: Pf3D7_0523000) | ||||
| mdr1-out-F2 | 5 | CCCAGGTGTTTTATCTGCACA | NA | 960544-960564 |
| mdr1-out-R2 | 5 | AGATGCAATTCTGTGGGCAA | NA | 962011-961992 |
| mdr1-in-F2 | 5 | TTTGTCCAATTGTTGCAGCTGTATTAACTTT | 2 | 960672-960702 |
| mdr1-in-R2 | 5 | TGCATTTTCTGAATCTCCTTTTAAGGACATT | 2 | 961159-961129 |
| mdr1-in-F3 | 5 | GGTAAAGTTGATATTAAAGATGTAAATTTCC | 2 | 961259-961289 |
| mdr1-in-R3 | 5 | TGGTCCAACATTTGTATCATATTTATTTGG | 2 | 961810-961781 |
| Chloroquine resistance transporter (pfcrt: PF3D7_070900) | ||||
| crt-out-F | 7 | CAAGCAAAAATGACGAGCGT | NA | 403259-403278 |
| crt-out-R | 7 | CCAGTAGTTCTTGTAAGACCTATGA | NA | 404035-404011 |
| crt-in-F | 7 | TGGCTCACGTTTAGGTGGAGGTTCTTG | 2 | 403491-403517 |
| crt-in-R | 7 | CATACAAATAAAGTTGTGAGTTTCGGATGTTAC | NA | 403704-403672 |
| Note: Blank references denote that the primer was created by this author. Manuscript in preparation. | ||||
| 1 2 Nag et al., 2017 | ||||
| a Nucleotide position relative ot the 3D7 v3 reference genome | ||||
Multiplex 2: crt, mdr1 (1034, 1042, 1246)
Primers
Round 1 PCR primers were designed using Geneious Prime R9 to target larger fragments that surrounded the codons of interest per marker. The forward and reverse primers for pfmdr1.1.2 and pfmdr1.1.3 and the forward primer for pfcrt from (Nag et al. 2017) were used as the round 2 PCR primers, and a novel pfcrt reverse primer was developed using Geneious Prime R9.
PCR Instructions
Round 1.
The first round PCR was carried out in a total volume of 25 μL with 1 x buffer, 500 uM dNTPs mix (Promega), 5 mM MgCl2, 200 nM of each primer (forward (F) and reverse (R)), 1.3 units of GoTaq Flexi Polymerase (Promega) and only 2 μL of genomic DNA.
| Reagent | Final Concentration | Volume x1 (μL) | Volume x8 (μL) |
|---|---|---|---|
| Water | 9.49 | 75.92 | |
| 5X Buffer | 1x | 5.00 | 40.00 |
| MgCl2 (25mM) | 5 mM | 5.00 | 40.00 |
| dNTP | 0.5 μM | 1.25 | 10.00 |
| mdr1-2-out-F | 0.2 μM | 0.50 | 4.00 |
| mdr1-2-out-R | 0.2 μM | 0.50 | 4.00 |
| crt-out-F | 0.2 μM | 0.50 | 4.00 |
| crt-out-R | 0.2 μM | 0.50 | 4.00 |
| G2 Flexi Taq (5U/μL) | 1.3 U/μL | 0.26 | 2.08 |
Cycling conditions:
- 95°C/2 min
- 40 cycles of:
- 95°C/20 sec,
- 58°C/2 min,
- 72/2 min;
- 72°C/10 min
- Resting at 4°C.
Round 2.
For both pfmdr1 markers (mdr1-2/mdr1-3), the simplex PCR was performed in separate reactions for each inner primer pair with a total volume of 25μL, with a master mix that contained 1x Buffer, 500 uM dNTPs mix, 5 mM MgCl2, 300 nM per primer (F/R), 1.3 units of GoTaq Flexi Polymerase and 1 μL of PCR product from the first round.
| Reagent | Final Concentration | Volume x1 (μL) | Volume x8 (μL) |
|---|---|---|---|
| Water | 10.99 | 87.92 | |
| 5X Buffer | 1x | 5.00 | 40.00 |
| MgCl2 (25mM) | 5 mM | 5.00 | 40.00 |
| dNTP | 0.5 μM | 1.25 | 10.00 |
| mdr1-2-in-F | 0.3 μM | 0.75 | 6.00 |
| mdr1-2-in-R | 0.3 μM | 0.75 | 6.00 |
| G2 Flexi Taq (5U/μL) | 1.3 U/μL | 0.26 | 2.08 |
Cycling conditions:
- 95°C/2 min
- 40 cycles of:
- 95°C/20 sec
- 58°C/2 min
- 72/2 min;
- 72°C/10 min
- Resting at 4°C.
For both pfmdr1 markers (mdr1-2/mdr1-3), the simplex PCR was performed in separate reactions for each inner primer pair with a total volume of 25μL, with a master mix that contained 1x Buffer, 500 uM dNTPs mix, 5 mM MgCl2, 300 nM per primer (F/R), 1.3 units of GoTaq Flexi Polymerase and 1 μL of PCR product from the first round.
| Reagent | Final Concentration | Volume x1 (μL) | Volume x8 (μL) |
|---|---|---|---|
| Water | 10.99 | 87.92 | |
| 5X Buffer | 1x | 5.00 | 40.00 |
| MgCl2 (25mM) | 5 mM | 5.00 | 40.00 |
| dNTP | 0.5 μM | 1.25 | 10.00 |
| mdr1-3-in-F | 0.3 μM | 0.75 | 6.00 |
| mdr1-3-in-R | 0.3 μM | 0.75 | 6.00 |
| G2 Flexi Taq (5U/μL) | 1.3 U/μL | 0.26 | 2.08 |
Cycling conditions:
- 95°C/2 min
- 40 cycles of:
- 95°C/20 sec
- 58°C/2 min
- 72/2 min;
- 72°C/10 min
- Resting at 4°C.
For pfcrt, the master mix contained 1x Buffer, 500 uM dNTPs mix, 5 mM MgCl2, 200 nM per primer (F/R), 1.3 units of GoTaq Flexi Polymerase and 1 μL of PCR product from the first round.
| Reagent | Final Concentration | Volume x1 (μL) | Volume x8 (μL) |
|---|---|---|---|
| Water | 11.49 | 91.92 | |
| 5X Buffer | 1x | 5.00 | 40.00 |
| MgCl2 (25mM) | 5 mM | 5.00 | 40.00 |
| dNTP | 0.5 μM | 1.25 | 10.00 |
| crt-in-F | 0.2 μM | 0.50 | 4.00 |
| crt-in-R | 0.2 μM | 0.50 | 4.00 |
| G2 Flexi Taq (5U/μL) | 1.3 U/μL | 0.26 | 2.08 |
Cycling conditions:
- 95°C/2 min
- 40 cycles of:
- 95°C/20 sec
- 62°C/2 min
- 72/2 min;
- 72°C/10 min
- Resting at 4°C.
Final Sequences
| Marker | Length | PCR_Round | Codons |
|---|---|---|---|
| Multidrug resistance gene 1 (pfmdr1: Pf3D7_0523000) | |||
| mdr1-2 Round 1 Product | 1468 | 1 | |
| mdr1-2 | 488 | 2 | 1034, 1042 |
| mdr1-3 | 552 | 2 | 1246 |
| Chloroquine resistance transporter (pfcrt: PF3D7_070900) | |||
| crt Round 1 Product | 777 | 1 | |
| crt | 214 | 2 | 72, 73, 74, 75, 76 |