Multiplex 4: aat1, pfs47

Primers

Round 1 PCR primers were obtained from (Onyango et al. 2021) and round 2 PCR primers were designed using Geneious Prime R9 to target smaller fragments. Novel pfaat1 primers were designed using Geneious Prime R9 for both round 1 and round 2 PCR primers surrounding the codons of interest.

Table 8. Details about primers used in Multiplex 4 of the ALARMcoding PCR genotyping protocol
Primer Chromosome Sequence (5' to 3') Reference Nucleotide positiona
Putative amino acid transporter (pfaat1r: PF3D7_0629500)
aat1-out-F 6 GTAGAACATTTAGTCGATTTACACC NA 1215527-1215503
aat1-out-R 6 TGGCTGAATATCCAGTTCTT NA 1214559-1214578
aat1-in-F 6 TGTACCTCGTCATTAGAACA NA 1215345-1215326
aat1-in-R 6 CATTTGGTTGTTGAGAGAAGG NA 1214898-1214918
6-cysteine protein (pfs47r: PF3D7_1346800)
pfs47-out-F 13 ATGTGTATGGGAAGAATGATCA 3 1880194-1880173
pfs47-out-R 13 ACAAGTTCATTCATATGCTAACATA 3 1878865-1878889
pfs47-in-F1 13 Same as pfs47-out-F 3 1880194-1880173
pfs47-in-R1 13 ATCACTGAACGATGAATTTATTGCA NA 1879805-1879829
pfs47-in-F2 13 GGATTAGTAAAAATAATTTTAAGAAACC NA 1879678-1879651
pfs47-in-R2 13 ACATATACGTTCTTCTTCATTTGG NA 1879250-1879273
Note: Blank references denote that the primer was created by this author. Manuscript in preparation.
1 2 3 Onyango et al., 2021
a Nucleotide position relative ot the 3D7 v3 reference genome

PCR Instructions

Round 1.

The first round PCR was carried out in a total volume of 25 μL with 1 x buffer, 500 uM dNTPs mix (Promega), 5 mM MgCl2, 200 nM of each primer (forward (F) and reverse (R)), 1.3 units of GoTaq Flexi Polymerase (Promega) and only 2 μL of genomic DNA.

Reagent Final Concentration Volume x1 (μL) Volume x8 (μL)
Water 9.49 75.92
5X Buffer 1x 5.00 40.00
MgCl2 (25mM) 5 mM 5.00 40.00
dNTP 0.5 μM 1.25 10.00
K13-out-F 0.2 μM 0.50 4.00
K13-out-R 0.2 μM 0.50 4.00
mdr1-1-out-F 0.2 μM 0.50 4.00
mdr1-1-out-R 0.2 μM 0.50 4.00
G2 Flexi Taq (5U/μL) 1.3 U/μL 0.26 2.08

Cycling conditions:

  • 95°C/2 min
  • 40 cycles of:
    • 95°C/20 sec,
    • 58°C/2 min,
    • 72/2 min;
  • 72°C/10 min
  • Resting at 4°C.

Round 2.

The second-round simplex PCRs were carried out in separate reactions per inner fragment primer pair.

For pfaat1, there was a total volume of 25 μL containing 1x Buffer, 500 uM dNTPs mix, 5 mM MgCl2, 200 nM of each primer (F/R), 1.3 units of GoTaq Flexi Polymerase and 1 μL of PCR product from the first round.

Reagent Final Concentration Volume x1 (μL) Volume x8 (μL)
Water 14.49 115.92
5X Buffer 1x 5.00 40.00
MgCl2 (25mM) 2 mM 2.00 16.00
dNTP 0.5 μM 1.25 10.00
aat1-in-F 0.2 μM 0.50 4.00
aat1-in-R 0.2 μM 0.50 4.00
G2 Flexi Taq (5U/μL) 1.3 U/μL 0.26 2.08

Cycling conditions:

  • 95°C/2 min
  • 40 cycles of:
    • 95°C/20 sec
    • 56°C/2 min
    • 72/2 min;
  • 72°C/10 min
  • Resting at 4°C.

For pfs47 fragments 1 and 2, there conditions were as follows: a total volume of 20 μL containing 1x Buffer, 125 uM dNTPs mix, 2 mM MgCl2, 125 nM of each primer (F/R), 0.4 units of GoTaq Flexi Polymerase and 1 μL of PCR product from the first round.

Reagent Final Concentration Volume x1 (μL) Volume x8 (μL)
Water 11.07 88.56
5X Buffer 1x 4.00 32.00
MgCl2 (25mM) 2 mM 1.60 12.80
dNTP 0.125 μM 0.25 2.00
pfs47-1-in-F 0.125 μM 1.00 8.00
pfs47-1-in-R 0.125 μM 1.00 8.00
G2 Flexi Taq (5U/μL) 0.4 U/μL 0.08 0.64

Cycling conditions:

  • 95°C/2 min
  • 40 cycles of:
    • 95°C/20 sec
    • 59°C/2 min
    • 72/2 min;
  • 72°C/10 min
  • Resting at 4°C.

For pfs47 fragments 1 and 2, there conditions were as follows: a total volume of 20 μL containing 1x Buffer, 125 uM dNTPs mix, 2 mM MgCl2, 125 nM of each primer (F/R), 0.4 units of GoTaq Flexi Polymerase and 1 μL of PCR product from the first round.

Reagent Final Concentration Volume x1 (μL) Volume x8 (μL)
Water 11.07 88.56
5X Buffer 1x 4.00 32.00
MgCl2 (25mM) 2 mM 1.60 12.80
dNTP 0.125 μM 0.25 2.00
pfs47-1-in-F 0.125 μM 1.00 8.00
pfs47-1-in-R 0.125 μM 1.00 8.00
G2 Flexi Taq (5U/μL) 0.4 U/μL 0.08 0.64

Cycling conditions:

  • 95°C/2 min
  • 40 cycles of:
    • 95°C/20 sec
    • 59°C/2 min
    • 72/2 min;
  • 72°C/10 min
  • Resting at 4°C.

Final Sequences

Table 9. Details about sequences genotyped in Multiplex 4 of the ALARMcoding protocol
Marker Length PCR_Round Codons
Putative amino acid transporter (pfaat1r: PF3D7_0629500)
aat1 Round 1 Product 969 1
aat1 448 2 258, 313
6-cysteine protein (pfs47r: PF3D7_1346800)
pfs47 Round 1 Product 1320 1
pfs47-1 390 2 1-120
pfs47-2 429 2 172-302
Back to top

References

Onyango, Shirley A, Kevin O Ochwedo, Maxwell G Machani, Collince J Omondi, Isaiah Debrah, Sidney O Ogolla, Ming-Chieh Lee, et al. 2021. “Genetic diversity and population structure of the human malaria parasite Plasmodium falciparum surface protein Pfs47 in isolates from the lowlands in Western Kenya.” PLoS ONE 16 (11): e0260434. https://doi.org/10.1371/journal.pone.0260434 PMID - 34843560.