Primers
The round 1 PCR primers were designed using Geneious Prime R9 to target larger fragments that encapsulated the primers described in (Nag et al. 2017) that were used as the round 2 PCR primers.
Table 6. Details about primers used in Multiplex 3 of the ALARMcoding PCR genotyping protocol
| Dihydropteroate synthase (pfdhps: PF3D7_0810800) |
| dhps-out-F |
8 |
ACAACACACAGATATAGCATACTTTT |
NA |
549342-549367 |
| dhps-out-R |
8 |
AATAGCTGTAGGAAGCAATTGC |
NA |
550530-550509 |
| dhps-in-F1 |
8 |
ACCATCAGATGTTTATATAACAAATATGTG |
2 |
549417-549446 |
| dhps-in-R1 |
8 |
CTGGATTATTTGTACAAGCACTAATATCA |
2 |
549909-549881 |
| dhps-in-F2 |
8 |
AGAATGTGTTGATAATGATTTAGTTGATAT |
2 |
549845-549874 |
| dhps-in-R2 |
8 |
GATATAAAAGTTGATCCTTGTCTTTCCT |
2 |
550365-550338 |
| Dihydrofolate reductase (pfdhfr: PF3D7_0417200) |
| dhfr-out-F |
4 |
GCCATTTTTGTATTCCCAAATAGC |
NA |
747913-747936 |
| dhfr-out-R |
4 |
TGTCATCATTCTTTAAAGGCATATCA |
NA |
748853-748828 |
| dhfr-in-F |
4 |
ATGATGGAACAAGTCTGCGACGTTTTCGA |
2 |
748088-748116 |
| dhfr-in-R |
4 |
CTAAAAATTCTTGATAAACAACGGAACCTCC |
2 |
748610-748580 |
| Note: Blank references denote that the primer was created by this author. Manuscript in preparation. |
|
|
|
|
| 1 2 Nag et al., 2017 |
|
|
|
|
| a Nucleotide position relative ot the 3D7 v3 reference genome |
|
|
|
|
PCR Instructions
Round 1.
The first round PCR was carried out in a total volume of 25 μL with 1 x buffer, 500 uM dNTPs mix (Promega), 5 mM MgCl2, 200 nM of each primer (forward (F) and reverse (R)), 1.3 units of GoTaq Flexi Polymerase (Promega) and only 2 μL of genomic DNA.
| Water |
|
9.49 |
75.92 |
| 5X Buffer |
1x |
5.00 |
40.00 |
| MgCl2 (25mM) |
5 mM |
5.00 |
40.00 |
| dNTP |
0.5 μM |
1.25 |
10.00 |
| K13-out-F |
0.2 μM |
0.50 |
4.00 |
| K13-out-R |
0.2 μM |
0.50 |
4.00 |
| mdr1-1-out-F |
0.2 μM |
0.50 |
4.00 |
| mdr1-1-out-R |
0.2 μM |
0.50 |
4.00 |
| G2 Flexi Taq (5U/μL) |
1.3 U/μL |
0.26 |
2.08 |
Cycling conditions:
- 95°C/2 min
- 40 cycles of:
- 95°C/20 sec,
- 58°C/2 min,
- 72/2 min;
- 72°C/10 min
- Resting at 4°C.
Round 2.
The second round of the nested PCR was carried out in separate reactions containing a single inner fragment primer pair and with a total volume of 25 μL containing 1x Buffer, 500 uM dNTPs mix, 5 mM MgCl2, 200 nM of each primer (F/R), 1.3 units of GoTaq Flexi Polymerase and 1 μL of PCR product from round 1.
| Water |
|
11.49 |
91.92 |
| 5X Buffer |
1x |
5.00 |
40.00 |
| MgCl2 (25mM) |
5 mM |
5.00 |
40.00 |
| dNTP |
0.5 μM |
1.25 |
10.00 |
| dhps-1-in-F |
0.2 μM |
0.50 |
4.00 |
| dhps-1-in-R |
0.2 μM |
0.50 |
4.00 |
| G2 Flexi Taq (5U/μL) |
1.3 U/μL |
0.26 |
2.08 |
| Water |
|
11.49 |
91.92 |
| 5X Buffer |
1x |
5.00 |
40.00 |
| MgCl2 (25mM) |
5 mM |
5.00 |
40.00 |
| dNTP |
0.5 μM |
1.25 |
10.00 |
| dhps-2-in-F |
0.2 μM |
0.50 |
4.00 |
| dhps-2-in-R |
0.2 μM |
0.50 |
4.00 |
| G2 Flexi Taq (5U/μL) |
1.3 U/μL |
0.26 |
2.08 |
| Water |
|
11.49 |
91.92 |
| 5X Buffer |
1x |
5.00 |
40.00 |
| MgCl2 (25mM) |
5 mM |
5.00 |
40.00 |
| dNTP |
0.5 μM |
1.25 |
10.00 |
| dhfr-in-F |
0.2 μM |
0.50 |
4.00 |
| dhfr-in-R |
0.2 μM |
0.50 |
4.00 |
| G2 Flexi Taq (5U/μL) |
1.3 U/μL |
0.26 |
2.08 |
Cycling conditions for each simplex reaction:
- 95°C/2 min
- 40 cycles of:
- 95°C/20 sec
- 58°C/2 min
- 72/2 min;
- 72°C/10 min
- Resting at 4°C.
Final Sequences
Table 7. Details about sequences genotyped in Multiplex 3 of the ALARMcoding protocol
| Dihydropteroate synthase (pfdhps: PF3D7_0810800) |
| dhps Round 1 Product |
1189 |
1 |
|
| dhps-1 |
493 |
2 |
431, 436, 437 |
| dhps-2 |
521 |
2 |
540, 581, 613 |
| Dihydrofolate reductase (pfdhfr: PF3D7_0417200) |
| dhfr Round 1 Product |
766 |
1 |
|
| dhfr |
523 |
2 |
16, 50, 51, 59, 108, 164 |
Back to topReferences
Nag, Sidsel, Marlene D Dalgaard, Poul-Erik Kofoed, Johan Ursing, Maria P Crespo, Lee O’Brien Andersen, Frank Møller Aarestrup, Ole Lund, and Michael Alifrangis. 2017.
“High throughput resistance profiling of Plasmodium falciparum infections based on custom dual indexing and Illumina next generation sequencing-technology.” Scientific Reports 7 (1): 2398. https://doi.org/
10.1038/s41598-017-02724-x PMID - 28546554.